DNA to RNA to Coding table

[Legacy 252697]

I'm making a DNA-RNA-Codon table for translating multiple codons. Before I start my question, let me give a brief introduction.

DNA is composed of two strands (5'-3' and 3'-5')(you can see that in the picture). Now, each strand is composed of nucleotides (A,G,T,C). A pairs with T and T to A, C pairs with G and G to C. In RNA, T is replaced by U, so: A pairs with U and U to A, C pairs G and G to C, T pairs with A. You can see there is T-A pairing in RNA because RNA is derived from DNA (see Transcription).
Now, "codons" is a set of 3 nucleotides. Codons encode for a specific amino acid (see Translation). Here comes my problem: translation or the coding of the codons starts from "AUG" sequence from the RNA. What I want to happen is that a function searches for the first "AUG" sequence and start coding from there; and end coding in a stop codons (UAG, UAA, UGA).
For example: RNA sequence is "UGCGAAUGCGCAGCUAAUAGA2A". Remember that codon is a set of 3 nucleotides. What happens in my workbook is that it coding starts at UGC. As I said earlier, translation starts at AUG sequence. So:
AUG CGC AGC UAA UAG. How will I do that?

Here's the link for my work: https://skydrive.live.com/redir?resid=1B5A5D3F2CD9BD86!333&authkey=!APe07DoRZOR9c8U

 

[Pup Denab]

Hi Rollanddarriz
I think you are over complicating this, it should be as easy, as this formula
=MID(A1,FIND("AUG",A1,1),15)
Your DNA code in cell A1 UGCGAAUGCGCAGCUAAUAGA2A
the formula in cell B1

All you need do is list your DNA codes down the page, the formula will extract the correct RNA, but this result will not have spaces, so a simple text to columns would resolve this

 

[Teeroy]

I can't tell from your data structure where you are placing the codon string to extract the RNA sub-sequence so I've assumed for testing it was in A1. Try the following formula as an array formula (entered with CTRL+SHIFT+Enter) and replace A1 with the cell containing the string.

=IF(ISERROR(SEARCH("AUG",A1)),"",MID(A1,SEARCH("AUG",A1)+3,MIN(IF(ISERROR(SEARCH(W$24:Y$24,A1)),1E+99,SEARCH(W$24:Y$24,A1)))-(SEARCH("AUG",A1)+3)))

The only thing about this formula is if a stop codon isn't found it will return the sequence from the AUG codon to the end. I didn't include anything to exclude this as the formula was long enough already .